FANDOM


Alternative, or suboptimal structures are structures that a given sequence could fold into aside from the minimum free energy structure. As an RNA folds, it may pass through several suboptimal structures before it adopts a stable structure. These alternative structures may also exist in equilibrium with one another, and the MFE structure.


ExampleEdit

The following examples show two suboptimal structures and the minimum free energy structure for the sequence:

GGAAACCGCCCGCGCGGGCGCGGGCGAAAACGCCCGCGAAACCGCCGCGAAAACGCGGCGGCCCGCGCGGGCGGAAAAGAAACAACAACAACAAC


Subopt01

Suboptimal structure #1

Notice that the second suboptimal structure has a rather low value of free energy. Many stable GC pairs would have to be broken in order to bring this from the second suboptimal structure to the minimum free energy structure.
Subopt02

Suboptimal structure #2

This is of the several downsides of "christmas tree" designs in lab.
Mfepickaxe

MFE structure

Ad blocker interference detected!


Wikia is a free-to-use site that makes money from advertising. We have a modified experience for viewers using ad blockers

Wikia is not accessible if you’ve made further modifications. Remove the custom ad blocker rule(s) and the page will load as expected.